@[email protected] to [email protected] • 1 year agoAACGTCATAGCCTGATTACCAGTAGGTACTAGlemmy.mlimagemessage-square11fedilinkarrow-up1437arrow-down128file-text
arrow-up1409arrow-down1imageAACGTCATAGCCTGATTACCAGTAGGTACTAGlemmy.ml@[email protected] to [email protected] • 1 year agomessage-square11fedilinkfile-text
An image of Mr Krabs saying “Spanchbab me boy.I sequenced me own genome AACGTCATAGCCTGATTACCAGTAGGTACTAG”
minus-squareGruxxlinkfedilink19•1 year agoUgh it didn’t blast or translate EMBOSS_001_1 NVIALPVGTX EMBOSS_001_2 TSPDYQVLX EMBOSS_001_3 RHSLITSRY EMBOSS_001_4 STYW*SGYDV EMBOSS_001_5 YLLVIRLRX EMBOSS_001_6 LVPTGNQAMTX
minus-square@[email protected]linkfedilink3•1 year agoOut of the loop - what is the joke supposed to be? If this is neither a real sequence nor a hidden message. Is it something Krusty Krab says in the show? Is it just funny because it is absurd?
Ugh it didn’t blast or translate
Out of the loop - what is the joke supposed to be? If this is neither a real sequence nor a hidden message. Is it something Krusty Krab says in the show? Is it just funny because it is absurd?
If “reading” the sequence, it sounds similar to Mr Krab’s laugh