@[email protected] to [email protected] • 2 years agoAACGTCATAGCCTGATTACCAGTAGGTACTAGlemmy.mlimagemessage-square11fedilinkarrow-up1436arrow-down128file-text
arrow-up1408arrow-down1imageAACGTCATAGCCTGATTACCAGTAGGTACTAGlemmy.ml@[email protected] to [email protected] • 2 years agomessage-square11fedilinkfile-text
An image of Mr Krabs saying “Spanchbab me boy.I sequenced me own genome AACGTCATAGCCTGATTACCAGTAGGTACTAG”
minus-square@[email protected]linkfedilink3•2 years agoOut of the loop - what is the joke supposed to be? If this is neither a real sequence nor a hidden message. Is it something Krusty Krab says in the show? Is it just funny because it is absurd?
Out of the loop - what is the joke supposed to be? If this is neither a real sequence nor a hidden message. Is it something Krusty Krab says in the show? Is it just funny because it is absurd?
If “reading” the sequence, it sounds similar to Mr Krab’s laugh