@[email protected] to [email protected] • 2 years agoAACGTCATAGCCTGATTACCAGTAGGTACTAGlemmy.mlimagemessage-square11fedilinkarrow-up1436arrow-down128file-text
arrow-up1408arrow-down1imageAACGTCATAGCCTGATTACCAGTAGGTACTAGlemmy.ml@[email protected] to [email protected] • 2 years agomessage-square11fedilinkfile-text
An image of Mr Krabs saying “Spanchbab me boy.I sequenced me own genome AACGTCATAGCCTGATTACCAGTAGGTACTAG”
minus-square@[email protected]linkfedilink1•2 years agoOh cool I didn’t know that stuff, it’s super interesting
There is also epigenetic modifications to be considered
Oh cool I didn’t know that stuff, it’s super interesting