An image of Mr Krabs saying “Spanchbab me boy.I sequenced me own genome AACGTCATAGCCTGATTACCAGTAGGTACTAG”

  • @[email protected]
    link
    fedilink
    102 years ago

    If we ignore the mutations in the life of an individual, it would actually only be a few hundreds megabytes. Or if we already have a template of a human genome and we only code the difference between them and the human we want to copy, a few megabytes is enough since we all share A LOT of sequences

    Wikipedia: Human genome#Information content