An image of Mr Krabs saying “Spanchbab me boy.I sequenced me own genome AACGTCATAGCCTGATTACCAGTAGGTACTAG”

  • @[email protected]
    link
    fedilink
    51 year ago

    I wonder if theoretically you could share humans through the internet? Share your sequence and someone can download it and build it with a theoretical machine. Would probably be a few Petabytes of data though like you can see in that Black Mirror episode with that spaceship.